| Gene name |
SPAC2E12.03c |
| Gene ID |
11/B11 |
| Gene synonyms/obsolete |
|
| Gene product |
G-protein coupled
receptor activity; PQ loop; similar to Sp SPAC17C9.10;
nutrient sensor for sexual differentiation and/or stress
response pathways |
| Entry clone |
Cloned |
| ORF length (unspliced) |
852 |
| ORF length (spliced) |
|
| Entry clone length |
852 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
150C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2E12.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCAGTTCTACGACTAC |
| Rev primer name |
SPAC2E12.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGGGATTTGGATGGCGCTT |
| Amino acid length |
283 |
| Molecular weight |
31.6 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQAMLILTI |
| Localization (YFP) |
Golgi; periphery at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss, DeltaVision
|