| Gene name |
SPAC9E9.04 |
| Gene ID |
11/B10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; predicted coiled-coil region (C-term); similar to
mammalian agb B-cell receptor associated protein and human
tumour associated antigen |
| Entry clone |
Cloned |
| ORF length (unspliced) |
852 |
| ORF length (spliced) |
567 |
| Entry clone length |
852 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
388T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC9E9.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGATTTACTACATGAT |
| Rev primer name |
SPAC9E9.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATATCCTTCTTCTTTTCG |
| Amino acid length |
188 |
| Molecular weight |
21.2 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKITIICILIL |
| Localization (YFP) |
ER |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |