| Gene name |
SPBC31F10.12 |
| Gene ID |
11/E02 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; PUA domain; RNA-binding protein; involved in RNA
modification |
| Entry clone |
Cloned |
| ORF length (unspliced) |
860 |
| ORF length (spliced) |
555 |
| Entry clone length |
860 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
462A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31F10.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGCTAACCTCAACAG |
| Rev primer name |
SPBC31F10.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTAAAATAGTCTTCCAC |
| Amino acid length |
184 |
| Molecular weight |
20.4 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |