| Gene name |
SPAC19B12.12c |
| Gene ID |
12/A03 |
| Gene synonyms/obsolete |
yip11; yip1;
yip1-a |
| Gene product |
possibly involved in
spliceosomal snRNP biogenesis; structural similarity with SMN
protein; smn1/yab8 interacting protein based on 2 hybrid data
and similar to human SIP1; involved in spliceosomal snRNP
biogenesis; similar to Sp yip12 (paralog); duplicated in Sp;
telomerase associated (implicated); no apparent Sc
ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
887 |
| ORF length (spliced) |
708 |
| Entry clone length |
887 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC19B12.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCTCGAAAAGAAAAAG |
| Rev primer name |
SPAC19B12.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTTGAAAGAGATCTTTT |
| Amino acid length |
235 |
| Molecular weight |
26.9 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |