| Gene name |
SPAC18G6.03 |
| Gene ID |
13/C02 |
| Gene synonyms/obsolete |
ypt3 |
| Gene product |
small GTPase; Ypt
subfamily; essential; HEAT repeat; GTP-binding protein;
involved in intracellular protein transport; involved in
exocytosis; involved in cytokinesis; post-translational
modification, gerenylgerenylation @ C-terminal XCC; mutant
(ypt3-i5) displays defects in cytokinesis; mutant (ypt3-i5)
displays defects in cell wall integrity; mutant (ypt3-i5)
displays defects in vacuole fusion; mutant (ypt3-i5)
accumulated aberrant Golgi-like structures; functionally
connected to calcineurin |
| Entry clone |
Cloned |
| ORF length (unspliced) |
943 |
| ORF length (spliced) |
645 |
| Entry clone length |
943 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
684T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC18G6.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTCAAGAGGACGAATA |
| Rev primer name |
SPAC18G6.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAACATTGGGAAGAAGAC |
| Amino acid length |
214 |
| Molecular weight |
23.8 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |