Gene name |
SPAC823.05c |
Gene ID |
13/E10 |
Gene synonyms/obsolete |
tlg2 |
Gene product |
SNARE; 1 predicted
transmembrane helix; t-SNARE that functions in transport from
the endosome to the late Golgi and on the endocytic pathway
(By similarity); syntaxin/epimorphin family; 1 t-SNARE
coiled-coil homology domain |
Entry clone |
Cloned |
ORF length (unspliced) |
958 |
ORF length (spliced) |
906 |
Entry clone length |
958 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC823.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCTATCGAGACCGTAC |
Rev primer name |
SPAC823.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGAAGCAGTTTAATTGCC |
Amino acid length |
301 |
Molecular weight |
34.4 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFICFLIL/LIVALIVILAI |
Localization (YFP) |
Golgi; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |