| Gene name |
SPAC3A11.04 |
| Gene ID |
13/F12 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; conserved in D. melanogaster and mouse; no apparent
Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
966 |
| ORF length (spliced) |
711 |
| Entry clone length |
966 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
194T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGGTAATAGGACTATT |
| Rev primer name |
SPAC3A11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGTCTTGTTGCTTTTGTT |
| Amino acid length |
236 |
| Molecular weight |
27 |
| Isoelectric point (calc.) |
9.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |