| Gene name |
SPAC17G6.02c |
| Gene ID |
13/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in sphingoid
long-chain base release |
| Entry clone |
Cloned |
| ORF length (unspliced) |
975 |
| ORF length (spliced) |
|
| Entry clone length |
975 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
696G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17G6.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATTACGATAACGCTTT |
| Rev primer name |
SPAC17G6.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGCTCCTCAGAGGAGAAA |
| Amino acid length |
324 |
| Molecular weight |
35.9 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGQIIALII |
| Localization (YFP) |
Golgi?; periphery at
cell tip and site of septum formation; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |