| Gene name |
SPAC19B12.06c |
| Gene ID |
13/H12 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; rhomboid family protease; 5 predicted
transmembrane helices; predicted N-terminal signal sequence;
peptidase S54 family; similar to Sp SPCC790.03; similar to
S. cerevisiae YPL246C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
975 |
| ORF length (spliced) |
711 |
| Entry clone length |
975 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19B12.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCATTGAACTAGGAGA |
| Rev primer name |
SPAC19B12.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACAATACCACTGCTGTTA |
| Amino acid length |
236 |
| Molecular weight |
26 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTVIVALLTI/LGIVNIFLPI/LPQVVRMALAL/LDFSITIVLHL |
| Localization (YFP) |
Golgi |
| Comments for localization |
accumulated Golgi by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |