Gene name |
SPAC25G10.03 |
Gene ID |
14/E02 |
Gene synonyms/obsolete |
zip1 |
Gene product |
transcription factor;
bZIP (basic leucine zipper) transcription factor family;
overexpression suppresses Atf1 deletants |
Entry clone |
Cloned |
ORF length (unspliced) |
993 |
ORF length (spliced) |
|
Entry clone length |
993 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
208A:G / 281T:C /
935A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC25G10.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTTACTCCTAATAG |
Rev primer name |
SPAC25G10.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGTTAGAAGTAGGACGT |
Amino acid length |
330 |
Molecular weight |
36.1 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
multi-septated cells;
elongated cells |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |