| Gene name |
SPAC30D11.05 |
| Gene ID |
14/F10 |
| Gene synonyms/obsolete |
aps3 |
| Gene product |
AP-3 complex; involved
in vesicle mediated transport |
| Entry clone |
Cloned
(Re-cloned) |
| ORF length (unspliced) |
1002 |
| ORF length (spliced) |
498 |
| Entry clone length |
1002 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC30D11.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTACGCTGTTTTTAT |
| Rev primer name |
SPAC30D11.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAACCTAGTAGCAAAAGAA |
| Amino acid length |
165 |
| Molecular weight |
18.6 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAEVVSGGLVL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |