| Gene name |
SPBC1709.11c |
| Gene ID |
14/G10 |
| Gene synonyms/obsolete |
png2 |
| Gene product |
zinc finger protein;
zf-PHD finger; similar to human candidate tumour suppressor
p33(ING1) in their C-terminal regions; involved in chromatin
mediated transcriptional regulation; involved in
transcriptional regulation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1005 |
| ORF length (spliced) |
918 |
| Entry clone length |
1005 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1709.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGACGAGTGGAATTGA |
| Rev primer name |
SPBC1709.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGACGACTTTCAGATGAT |
| Amino acid length |
305 |
| Molecular weight |
34.8 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |