| Gene name |
SPBC28E12.05 |
| Gene ID |
14/G11 |
| Gene synonyms/obsolete |
SPBC3H7.17c |
| Gene product |
involved in
transcriptional activation; rrm RNA recognition motif
(inferred from context); similar to M. musculus TBP-binding
protein abt1; predicted coiled-coil regions |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1005 |
| ORF length (spliced) |
|
| Entry clone length |
1005 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC28E12.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAGCTGAACAATT |
| Rev primer name |
SPBC28E12.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAACCCTCCGCAAAACG |
| Amino acid length |
334 |
| Molecular weight |
38.9 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleolus>>nucleus |
| Comments for localization |
large bright dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |