Gene name |
SPBC28E12.05 |
Gene ID |
14/G11 |
Gene synonyms/obsolete |
SPBC3H7.17c |
Gene product |
involved in
transcriptional activation; rrm RNA recognition motif
(inferred from context); similar to M. musculus TBP-binding
protein abt1; predicted coiled-coil regions |
Entry clone |
Cloned# |
ORF length (unspliced) |
1005 |
ORF length (spliced) |
|
Entry clone length |
1005 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC28E12.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAGCTGAACAATT |
Rev primer name |
SPBC28E12.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAACCCTCCGCAAAACG |
Amino acid length |
334 |
Molecular weight |
38.9 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleolus>>nucleus |
Comments for localization |
large bright dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |