| Gene name |
SPBC409.20c |
| Gene ID |
15/G01 |
| Gene synonyms/obsolete |
psh3 |
| Gene product |
involved in the
secretory pathway; involved in exit of amino acid permeases
from the ER and appearance on the cell surface |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1037 |
| ORF length (spliced) |
648 |
| Entry clone length |
1037 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC409.20.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAAAAGATCCATATT |
| Rev primer name |
SPBC409.20.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGCGCTTTGAAACAGAT |
| Amino acid length |
215 |
| Molecular weight |
24 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLYLTALIL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |