| Gene name |
SPAC32A11.04c |
| Gene ID |
15/H05 |
| Gene synonyms/obsolete |
tif212; tif22;
SPAC6B12.17c |
| Gene product |
eukaryotic translation
initiation factor 2 beta subunit |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1046 |
| ORF length (spliced) |
966 |
| Entry clone length |
1046 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
159T:C / 442A:deletion
/ 443G:deletion / 444A:deletion / 708A:G |
| Comments |
K121 is deleted, but
in frame. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC32A11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAGACCGAAGCTGT |
| Rev primer name |
SPAC32A11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAACATGTTTTCTTTTT |
| Amino acid length |
321 |
| Molecular weight |
35.9 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
86 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |