| Gene name |
SPAC4D7.02c |
| Gene ID |
16/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
glycerophosphoryl
diester phosphodiesterase; hydrolyses deacylated phopholipids
to G3p and the corresponding alcohols |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1067 |
| ORF length (spliced) |
960 |
| Entry clone length |
1067 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
413A:G / 1016T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4D7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTTAACTACTCAAT |
| Rev primer name |
SPAC4D7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAACACAAAGGTTCTCAAT |
| Amino acid length |
319 |
| Molecular weight |
36.6 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |