Gene name |
SPAC2E1P5.04c |
Gene ID |
16/D04 |
Gene synonyms/obsolete |
cwg2 |
Gene product |
geranylgeranyltransferase type I (GGTase I), beta
subunit; required for beta-glucan synthesis; interacts
physically with Cwp1p; involved in the post-translational
C-terminal modification of several small GTPases, allowing
their targeting to the membrane |
Entry clone |
Cloned |
ORF length (unspliced) |
1068 |
ORF length (spliced) |
|
Entry clone length |
1068 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
86A:G / 675T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2E1P5.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTAACAAGAGCTAA |
Rev primer name |
SPAC2E1P5.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTCCCCTTGGCTGCTTGA |
Amino acid length |
355 |
Molecular weight |
40 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYGLALQLAL |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |