| Gene name |
SPBC3B9.10 |
| Gene ID |
16/E08 |
| Gene synonyms/obsolete |
vti1 |
| Gene product |
SNARE; involved in
secretory pathway; involved in vacuole fusion |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1072 |
| ORF length (spliced) |
645 |
| Entry clone length |
1072 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
985A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3B9.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGACGTACGAGCAAGA |
| Rev primer name |
SPBC3B9.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGAAATTTGCTATAAAGC |
| Amino acid length |
214 |
| Molecular weight |
24.7 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVILILLVL |
| Localization (YFP) |
Golgi?; vacuole;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |