| Gene name |
SPBC29A3.13 |
| Gene ID |
16/G08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; PWWP domain protein; involved in cell growth;
similar to Sp SPBC215.07C and SPAC23D3.01 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1080 |
| ORF length (spliced) |
|
| Entry clone length |
1080 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29A3.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAATGCCCGCACTAA |
| Rev primer name |
SPBC29A3.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATGCCTTTTATCGATGGT |
| Amino acid length |
359 |
| Molecular weight |
40.9 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
8 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |