| Gene name |
SPAC20G4.04c |
| Gene ID |
17/A02 |
| Gene synonyms/obsolete |
hus1 |
| Gene product |
PCNA related protein;
Hus1-Rad1-Rad9 checkpoint complex; involved in DNA replication
checkpoint; involved in DNA damage checkpoint (required);
involved in S/M checkpoint (required); sliding clamp and
clamp-loading complex; interacts physically with Rad1p;
interacts physically with Rad9p; interacts physically with
Rad17p; phosphorylated in response to DNA damage |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1088 |
| ORF length (spliced) |
864 |
| Entry clone length |
1088 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC20G4.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGATTTAAAACAAGGAT |
| Rev primer name |
SPAC20G4.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCCACATAGGTACTAATG |
| Amino acid length |
287 |
| Molecular weight |
32.7 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB;
nucleolus>nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |