| Gene name |
SPAC959.02 |
| Gene ID |
17/A01 |
| Gene synonyms/obsolete |
sec17 |
| Gene product |
alpha SNAP; involved
in intracellular protein transport; involved in ER to golgi
transport; NSF attachment protein; involved in secretory
pathway; involved in vacuole fusion; similar to S.
cerevisiae YBL050W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1087 |
| ORF length (spliced) |
870 |
| Entry clone length |
1087 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC959.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCGCAGACCCTGATCA |
| Rev primer name |
SPAC959.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTAAGTCATCTTCAGCT |
| Amino acid length |
289 |
| Molecular weight |
32.2 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |