| Gene name |
SPAC22F8.02c |
| Gene ID |
17/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
PvGal biosynthesis
protein Pvg5; predicted N-terminal signal sequence; involved
in cell wall biosynthesis; deletion mutant galactomannans
deficient for pyruvylated
galactose-beta-1,3-galactose-alpha-1,2-pyruvate (PvGal); no
apparent orthologs; Sp specific families |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1119 |
| ORF length (spliced) |
|
| Entry clone length |
1119 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
288A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F8.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCCTTCCATTACGGAT |
| Rev primer name |
SPAC22F8.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTTGCTTCCATTGTTCA |
| Amino acid length |
372 |
| Molecular weight |
43 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLFLFGSLIL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|