| Gene name |
SPBC651.03c |
| Gene ID |
17/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
TBC domain protein;
GTPase activating protein of Rab-like GTPase; non-essential
(pers. comm. Kathy Gould); involved in secretory pathway (IGI)
(pers. comm. Kathy Gould); no apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1122 |
| ORF length (spliced) |
|
| Entry clone length |
1122 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC651.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAAGAAGGAGATAAA |
| Rev primer name |
SPBC651.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAATTGGATGTGGACTTT |
| Amino acid length |
373 |
| Molecular weight |
42.5 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHDIAQILLL/LDGTVKQLQL |
| Localization (YFP) |
cytosol=nucleus;
periphery with discontinuity |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |