Gene name |
SPAC16.01 |
Gene ID |
18/F05 |
Gene synonyms/obsolete |
rho2 |
Gene product |
Rho family; small
GTPase; involved in cellular morphogenesis; involved in
septation; non-essential; overexpression results in loss of
cell polarity and is lethal |
Entry clone |
Cloned |
ORF length (unspliced) |
1175 |
ORF length (spliced) |
603 |
Entry clone length |
1175 |
No. of intron |
8 |
Sequence status |
Finished |
Sequence results |
173T:G / 215G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC16.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGCAATCTCAACCGAT |
Rev primer name |
SPAC16.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGAAATGATGCAGCATTTT |
Amino acid length |
200 |
Molecular weight |
22.2 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|