| Gene name |
SPBC902.06 |
| Gene ID |
19/A09 |
| Gene synonyms/obsolete |
|
| Gene product |
MT organizer;
coiled-coil region; non-essential; no apparent orthologs; Mto2
and the EMTOC are critical for anchoring the cytokinetic actin
ring to the medial region of the cell, and for the proper
coordination of mitosis with cytokinesis; Mto2 promotes the
ability of Mto1 to recruit the gamma tubunlin complex to a
subset of MTOCs away from the spindle pole body |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1194 |
| ORF length (spliced) |
|
| Entry clone length |
1194 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC902.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAACATAATTACCA |
| Rev primer name |
SPBC902.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGGGGAAGGAGTGTCTTGA |
| Amino acid length |
397 |
| Molecular weight |
44 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCRSLAELCL |
| Localization (YFP) |
SPB?; periphery at
site of septum formation; cytosol; cytoplasmic dots by over
expression |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |