Gene name |
SPCC16C4.08c |
Gene ID |
20/B08 |
Gene synonyms/obsolete |
skb15 |
Gene product |
interacts physically
with Shk1p; negative regulator of Shk1; WD repeat
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1262 |
ORF length (spliced) |
1026 |
Entry clone length |
1262 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
763T:C / 952A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC16C4.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCCGTTTTGTAGTTGG |
Rev primer name |
SPCC16C4.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGCATGCTTCGTCCTTTTC |
Amino acid length |
341 |
Molecular weight |
37.7 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |