| Gene name |
SPAC17C9.12 |
| Gene ID |
20/D01 |
| Gene synonyms/obsolete |
|
| Gene product |
MSP domain protein;
involved in sterol metabolism; involved in signal
transduction; interacts physically with Syb1p; similar to Sp
SPBC16G5.05c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1270 |
| ORF length (spliced) |
960 |
| Entry clone length |
1270 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1177T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17C9.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCTTGAATGTGATAG |
| Rev primer name |
SPAC17C9.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAACAGAAGGCCTATAAGG |
| Amino acid length |
319 |
| Molecular weight |
34 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTRLVKCDLEL |
| Localization (YFP) |
ambiguous structure;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |