| Gene name |
SPBC428.18 |
| Gene ID |
20/F09 |
| Gene synonyms/obsolete |
cdt1 |
| Gene product |
involved in DNA
replication (initiation) (required); regulated by DSC1/MBF
complex; essential; involved in DNA replication (required);
involved in mitosis (inhibition) (required); no apparent Sc
ortholog; expressed at G1-S phase; regulated by DSC1/MBF
complex |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1335 |
| ORF length (spliced) |
|
| Entry clone length |
1335 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
22A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC428.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATGTCGCGCCCTATA |
| Rev primer name |
SPBC428.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAATTTGAAAGAATAGTG |
| Amino acid length |
444 |
| Molecular weight |
49.9 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |