| Gene name |
SPBC20F10.03 |
| Gene ID |
20/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved eukaryotic
protein; developmental regulator-like; involved in signal
transduction; no apparent Sc ortholog; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1341 |
| ORF length (spliced) |
|
| Entry clone length |
1341 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1307A:G /
1313T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC20F10.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAAAAAAGATGGTAA |
| Rev primer name |
SPBC20F10.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTGAGAAAAGTAGACA |
| Amino acid length |
446 |
| Molecular weight |
50 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
423 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
| Microscope used for
observation |
DeltaVision |