Gene name |
SPBC20F10.03 |
Gene ID |
20/G05 |
Gene synonyms/obsolete |
|
Gene product |
conserved eukaryotic
protein; developmental regulator-like; involved in signal
transduction; no apparent Sc ortholog; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1341 |
ORF length (spliced) |
|
Entry clone length |
1341 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1307A:G /
1313T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC20F10.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAAAAAAGATGGTAA |
Rev primer name |
SPBC20F10.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTTGAGAAAAGTAGACA |
Amino acid length |
446 |
Molecular weight |
50 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
423 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
Microscope used for
observation |
DeltaVision |