Gene name |
SPAC23C4.05c |
Gene ID |
20/H06 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
hypothetical protein; similar to Sp SPBC365.12c (C-term); no
apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1350 |
ORF length (spliced) |
1296 |
Entry clone length |
1350 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
360A:G / 466T:C /
490C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23C4.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGCCAAGGTTTCTTCT |
Rev primer name |
SPAC23C4.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGCGAAAGTACAAAAGCC |
Amino acid length |
431 |
Molecular weight |
49.5 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHGALLALGI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |