Gene name |
SPBC428.03c |
Gene ID |
21/E07 |
Gene synonyms/obsolete |
pho4 |
Gene product |
thiamine-repressible
acid phosphatase; non-essential; similar to Sp SPBC21H7.03C
and PHO1 |
Entry clone |
Cloned |
ORF length (unspliced) |
1392 |
ORF length (spliced) |
|
Entry clone length |
1392 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC428.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTTAAGTGGTATTTC |
Rev primer name |
SPBC428.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTAGTAGACGGTAACGTTG |
Amino acid length |
463 |
Molecular weight |
52.1 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; Golgi? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |