| Gene name |
SPAC3A12.01c |
| Gene ID |
21/E11 |
| Gene synonyms/obsolete |
SPAC20G8.10c |
| Gene product |
involved in autophagy;
beclin related |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1395 |
| ORF length (spliced) |
|
| Entry clone length |
1395 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
730T:C / 1128A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A12.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGTATTTGTGTCAGAG |
| Rev primer name |
SPAC3A12.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGTTCGACTGCTTGTCC |
| Amino acid length |
464 |
| Molecular weight |
53.9 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
various size of moving
dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |