| Gene name |
SPAC6B12.15 |
| Gene ID |
21/E12 |
| Gene synonyms/obsolete |
cpc2; rkp1 |
| Gene product |
guanine nucleotide
regulatory protein; WD repeat protein; mammalian RACK1
homolog; phosphorylated by Ran1p; involved in conjugation;
involved in sporulation; involved in actin cytoskeletal
organization; protein kinase C-Pck2-signaling pathway;
interacts with pleckstrin homology domain to modulate
Pck2-mediated signaling process |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
1395 |
| ORF length (spliced) |
945 |
| Entry clone length |
1395 |
| No. of intron |
2 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC6B12.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAGAACAACTTGTGCT |
| Rev primer name |
SPAC6B12.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGGTAACTTGCCAGACA |
| Amino acid length |
314 |
| Molecular weight |
34.8 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|