Gene name |
SPAC4A8.04 |
Gene ID |
21/F12 |
Gene synonyms/obsolete |
isp6; prb1 |
Gene product |
serine protease;
involved in sexual differentiation; involved in RNA
degradation via regulation of the RNA degrading activity of
Pnu1p; similar to Sp SPAC1006.01 |
Entry clone |
Cloned |
ORF length (unspliced) |
1404 |
ORF length (spliced) |
|
Entry clone length |
1404 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
910T:C / 1284T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4A8.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAATTCCTTATTCAAA |
Rev primer name |
SPAC4A8.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTTGAGCACCATTGAAA |
Amino acid length |
467 |
Molecular weight |
49.3 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi? |
Comments for localization |
nearly no apparent
signal |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |