Gene name |
SPCC1753.06c |
Gene ID |
21/G09 |
Gene synonyms/obsolete |
SPCC162.12 |
Gene product |
hypothetical protein;
serine-rich protein; sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
1415 |
ORF length (spliced) |
1356 |
Entry clone length |
1415 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1753.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACGTCCATCCCTGTC |
Rev primer name |
SPCC1753.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCCTTGAGACCATAATTGT |
Amino acid length |
451 |
Molecular weight |
49.2 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at site of
septum formation; occasionally cytoplasmic microtubules;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol) |
Microscope used for
observation |
DeltaVision |