Gene name |
SPCC757.11c |
Gene ID |
21/G10 |
Gene synonyms/obsolete |
|
Gene product |
transporter; unknown
specificity; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1416 |
ORF length (spliced) |
|
Entry clone length |
1416 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC757.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGCAACAAAGTAATTT |
Rev primer name |
SPCC757.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCAAGGCGCAACTTGACC |
Amino acid length |
471 |
Molecular weight |
51.9 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPTITALVL/LMAFIWVGLFL/LGFVGCLVI/LAGIINVPLLL/LILNVMSVLAL |
Localization (YFP) |
Golgi; periphery at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |