| Gene name |
SPAC13F5.02c |
| Gene ID |
22/B07 |
| Gene synonyms/obsolete |
ptr6 |
| Gene product |
transcription
initiation factor TFIID subunit; involved in mRNA export
(required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1223 |
| ORF length (spliced) |
1182 |
| Entry clone length |
1223 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13F5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTAAGCTAAAAATTCG |
| Rev primer name |
SPAC13F5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAGGGTTATCGACAAGT |
| Amino acid length |
393 |
| Molecular weight |
45 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |