Gene name |
SPBP4H10.19c |
Gene ID |
22/B08 |
Gene synonyms/obsolete |
|
Gene product |
calreticulin/calnexin
homolog; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1224 |
ORF length (spliced) |
1146 |
Entry clone length |
1224 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
603T:C / 1029T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP4H10.19.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACCCTTCTTTTCTA |
Rev primer name |
SPBP4H10.19.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTAACAACCATAGAAAA |
Amino acid length |
381 |
Molecular weight |
43.4 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |