| Gene name |
SPAC30D11.10 |
| Gene ID |
23/B03 |
| Gene synonyms/obsolete |
rad22 |
| Gene product |
involved in DNA
repair; involved in meiotic recombination; involved in meiotic
gene conversion (required); interacts physically with Rhp51p;
involved in mating-type determination binds to double-strand
breaks; interacts physically with Rhp51p |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1410 |
| ORF length (spliced) |
|
| Entry clone length |
1410 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC30D11.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTGAGCAAAAACA |
| Rev primer name |
SPAC30D11.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCTTTTTTGGCTTTCTTA |
| Amino acid length |
469 |
| Molecular weight |
51.9 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
very strong signal of
one dot/cell by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |