| Gene name |
SPBC582.03 |
| Gene ID |
23/D02 |
| Gene synonyms/obsolete |
cdc13 |
| Gene product |
G2/mitotic-specific
cyclin; involved in control of mitosis, regulation of CDK
activity, DNA damage checkpoint, DNA replication checkpoint;
essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1449 |
| ORF length (spliced) |
|
| Entry clone length |
1449 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC582.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACCCGTCGTTTAAC |
| Rev primer name |
SPBC582.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATTCTTCATCTTTCATG |
| Amino acid length |
482 |
| Molecular weight |
55.6 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGIAALFI |
| Localization (YFP) |
SPB; nucleus; nuclear
dots; spindle microtubules |
| Comments for localization |
aggregates in nucleus
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |