Gene name |
SPBC1683.12 |
Gene ID |
23/D01 |
Gene synonyms/obsolete |
|
Gene product |
membrane transporter;
unknown specificity; similar to Sp SPAC11D3.18C and
SPAC1039.04 and SPAC1002.16C |
Entry clone |
Cloned |
ORF length (unspliced) |
1449 |
ORF length (spliced) |
|
Entry clone length |
1449 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
207T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1683.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGACTATGGAAGAAGA |
Rev primer name |
SPBC1683.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAAACATAAACAAAATCT |
Amino acid length |
482 |
Molecular weight |
54.1 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LISAISALWI/LPSILKLEL |
Localization (YFP) |
ER |
Comments for localization |
large ER structure by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |