| Gene name |
SPBC19G7.13 |
| Gene ID |
23/E08 |
| Gene synonyms/obsolete |
|
| Gene product |
Myb family; DNA
binding protein; involved in telomere maintenance; involved in
telomerase-dependent telomere maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1458 |
| ORF length (spliced) |
|
| Entry clone length |
1458 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1044T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19G7.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAAACGATCCTTAGA |
| Rev primer name |
SPBC19G7.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTCGCCGAAGATCGCCT |
| Amino acid length |
485 |
| Molecular weight |
54.6 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAAVYGALQI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
DeltaVision |