Gene name |
SPBC14C8.04 |
Gene ID |
23/E09 |
Gene synonyms/obsolete |
|
Gene product |
acetolactate synthase
(small subunit) |
Entry clone |
Cloned |
ORF length (unspliced) |
1461 |
ORF length (spliced) |
870 |
Entry clone length |
1461 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
513T:C / 1401A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC14C8.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCGCAAGAAGATGCGG |
Rev primer name |
SPBC14C8.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCAGGAGGAAGGAAAACC |
Amino acid length |
289 |
Molecular weight |
31.8 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots;
faint filamentous structures |
Comments for localization |
bright dots with faint
filaments |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |