Gene name |
SPBC14F5.10c |
Gene ID |
23/E10 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); protease
LON domain; no apparent Sc ortholog |
Entry clone |
Cloned# |
ORF length (unspliced) |
1461 |
ORF length (spliced) |
|
Entry clone length |
1461 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC14F5.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAAAGAAAGGCCAGG |
Rev primer name |
SPBC14F5.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAATGGTGCAAGCACTT |
Amino acid length |
486 |
Molecular weight |
56.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSYKITNLLPI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
cytosol=nucleus |
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |