Gene name |
SPAC23H3.13c |
Gene ID |
23/F07 |
Gene synonyms/obsolete |
gpa2; git8 |
Gene product |
guanine
nucleotide-binding protein (alpha-2 subunit); involved in
monitoring of nutrition, regulation of glucose repression, and
sporulation |
Entry clone |
Cloned |
ORF length (unspliced) |
1470 |
ORF length (spliced) |
1065 |
Entry clone length |
1470 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
519T:G / 1378A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23H3.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGATTTTTAATGGATT |
Rev primer name |
SPAC23H3.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACATTCCCGCTTCTTTC |
Amino acid length |
354 |
Molecular weight |
40.5 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
Comments for localization |
faint signals of SPB
and site of septum formation |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |