| Gene name |
SPBC1198.10c |
| Gene ID |
23/F09 |
| Gene synonyms/obsolete |
|
| Gene product |
asparagine-tRNA
ligase; involved in asparaginyl-tRNA aminoacylation;
asparagine-tRNA ligase activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1470 |
| ORF length (spliced) |
1326 |
| Entry clone length |
1470 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
81C:T / 190T:C /
783T:C / 1135T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1198.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAAATTCCAACTACC |
| Rev primer name |
SPBC1198.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAAAAATGGATCCTACT |
| Amino acid length |
441 |
| Molecular weight |
50.5 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRQIPHLRL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
almost no apparent
signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |