| Gene name |
SPCC285.11 |
| Gene ID |
23/F11 |
| Gene synonyms/obsolete |
|
| Gene product |
ubiquitin-regulatory
protein; UBX domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1471 |
| ORF length (spliced) |
1284 |
| Entry clone length |
1471 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
358A:G / 456T:C /
1184C:T / 1356T:C / 1426A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC285.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGGGTCTCGAAAACA |
| Rev primer name |
SPCC285.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATCCAGCTCCACCACC |
| Amino acid length |
427 |
| Molecular weight |
48.6 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |