| Gene name |
SPAC9G1.09 |
| Gene ID |
23/F12 |
| Gene synonyms/obsolete |
sid1 |
| Gene product |
PAK-related kinase;
GCK subfamily; serine/threonine protein kinase; no apparent
S. cerevisiae ortholog; essential; involved in the
regulation of septation; interacts physically with Cdc14p; Has
a role in the septation initiation network (SIN) required for
cytokinesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1472 |
| ORF length (spliced) |
1416 |
| Entry clone length |
1472 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC9G1.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATCCTCTCAATGCTAA |
| Rev primer name |
SPAC9G1.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCATTTAGACTTCTTCTT |
| Amino acid length |
471 |
| Molecular weight |
52.9 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAADIWSLGI |
| Localization (YFP) |
nucleus>>cytosol; SPB |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |