| Gene name |
SPAC17H9.19c |
| Gene ID |
23/G01 |
| Gene synonyms/obsolete |
cdt2 |
| Gene product |
WD repeat protein;
regulated by DSC1/MBF complex; involved in vegetative growth;
involved in sporulation; non-essential; involved in DNA
replication; functionally complemented by overexpression of
suc22; deletion sensitive to HU; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1473 |
| ORF length (spliced) |
|
| Entry clone length |
1473 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
973C:T / 1460T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17H9.19.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATGGACATTGGAAA |
| Rev primer name |
SPAC17H9.19.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTCACTAAATCCCCAA |
| Amino acid length |
490 |
| Molecular weight |
54.2 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |