| Gene name |
SPBC31E1.05 |
| Gene ID |
24/B02 |
| Gene synonyms/obsolete |
|
| Gene product |
nuclear pore complex;
involved in RNA export |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1493 |
| ORF length (spliced) |
1443 |
| Entry clone length |
1493 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31E1.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACAAAAACAACACC |
| Rev primer name |
SPBC31E1.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGCTCAAAGGAGAATTTG |
| Amino acid length |
480 |
| Molecular weight |
56.2 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
119/126 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCSIVSTYLDI |
| Localization (YFP) |
nuclear envelope;
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |